LETTER doi:10.1038/nature09822
Molecular regulation of sexual preference revealed
by genetic studies of 5-HTin the brains ofmalemice
Yan Liu1,2*, Yun’ai Jiang1,3*, Yunxia Si1, Ji-Young Kim4, Zhou-Feng Chen4 & Yi Rao1,5
Although the question of to whom a male directs his mating
attempts1,2 is a critical one in social interactions, little is known
about the molecular and cellular mechanisms controlling mammalian
sexual preference. Here we report that the neurotransmitter
5-hydroxytryptamine (5-HT)is required for male sexual preference.
Wild-type male mice preferred females over males, but males lacking
central serotonergic neurons lost sexual preference although
they were not generally defective in olfaction or in pheromone
sensing. A role for 5-HT was demonstrated by the phenotype of
mice lacking tryptophan hydroxylase 2 (Tph2), which is required
for the first step of 5-HT synthesis in the brain. Thirty-five minutes
after the injection of the intermediate 5-hydroxytryptophan
(5-HTP), which circumvented Tph2 to restore 5-HT to the wildtype
level, adult Tph2 knockout mice also preferred females over
males. These results indicate that 5-HT and serotonergic neurons
in the adult brain regulate mammalian sexual preference.
Interactions between members of the opposite sex are essential for
sexually reproducing animals. Evolutionary benefits have been proposed
for homo- and bisexual traits1,2, which exist in many animals2
from American bulls3 to Japanese rhesus monkeys4. Studies of animals
with different sexual preferences are essential for understanding the
seemingly simple decision of a male to court a female.
Research in Drosophila has uncovered genes required for Drosophila
courtship preference, but none of their homologues have been shown
to affect mammalian sexual preference. Research in mammals has
demonstrated that pheromone sensing in the periphery is important
for sexual preference. Male mice lacking Trpc2 (Trpc22/2), which
encodes a channel expressed in the vomeronasal organ, mounted other
males, emitted ultrasonic vocalizations (USVs) towards males and
were less aggressive towards males5,6. However, understanding of the
central mechanisms for sexual preference remains limited.
The neurotransmitter 5-HThas been implicated inmale sexual behaviours
such as erection, ejaculation and orgasm in mice and humans7,8.
Depletion of 5-HT by treating animals with p-chlorophenylalanine
(pCPA) or tryptophan-free diets induced male–male mounting9–11.
However, pCPA treatment was thought to increase sexual activity
whereas its effect on sexual preference has not been investigated.
Interpretation of pCPA results was complicated further by the lack of
specificity: pCPA may affect noradrenaline and dopamine at higher
concentrations12.
Almost all serotonergic neurons in the brain were missing from
embryogenesis to adulthood in Lmx1b conditional knockout mice in
which the floxed Lmx1b allele was deleted by ePet1-Cre13.We compared
the behaviours ofmalemice ofdifferent genotypes: ePet1-Cre/Lmx1bflox/
Lmx1bflox as homozygous mutants (Lmx1b2/2); their littermates ePet1-
Cre/Lmx1bflox/1 as heterozygous mutants (Lmx1b1/2); and Lmx1bflox/
Lmx1bflox without ePet1-Cre as the wild type (Lmx1b1/1). We also used
ePet1-Cre without Lmx1bflox as a control.
We tested first how a male responded in his home cage when a wildtype
target C57 male was introduced. Compared to the ePet1-Cre,
Lmx1b1/1 and Lmx1b1/2 controls, Lmx1b2/2 mice showed significantly
more mounting of male intruders (Fig. 1 and Supplementary
Movie 1; see Supplementary Data 1 for numbers of mice used and
statistics for all figures). The percentage of males who mounted target
males was significantly higher in Lmx1b2/2 males than ePet1-Cre,
Lmx1b1/2 and Lmx1b1/1 males (Fig. 1a). Lmx1b2/2 males mounted
with a shorter latency (Fig. 1b), higher frequency (Fig. 1c) and longer
duration (Fig. 1d). These results show that the absence of serotonergic
neurons in the brain increased male–male mounting.
A sexually dimorphic behavioural response of males is to emit 30–
110 kHz USVs when they encounter female mice or pheromones,
which may function as love songs to facilitate female receptivity14.
Lmx1b1/1, Lmx1b1/2 and Lmx1b2/2 males were similar in USVemission
towards females (Fig. 1e–g).However, the percentage ofLmx1b2/2
males emittingUSV towards males was significantly higher than that of
ePet1-Cre, Lmx1b1/1 or Lmx1b1/2 males (Fig. 1f). Numbers of USV
‘syllables’ emitted towards females were similar among ePet1-Cre,
Lmx1b1/1,Lmx1b1/2 andLmx1b2/2 males (Fig. 1g).Lmx1b2/2 males
emitted more USV‘syllables’ towards males than ePet1-Cre, Lmx1b1/1
and Lmx1b1/2. The number of USV emissions by Lmx1b2/2 males
towards males was approximately 720 times higher than that of
Lmx1b1/1 males (Fig. 1g).
AlthoughLmx1b2/2males still emittedmoreUSVs towards females,
the preference for females over males was significantly reduced: the
ratio of USVs towards females over that for males was only 3 for
Lmx1b2/2 males, significantly reduced from1,002 for ePet1-Cre males,
2,438 for Lmx1b1/1 males and 52 for Lmx1b1/2.
In the mating choice assay, an oestrous female C57 target mouse and
a sexually naive male C57 target mouse were introduced into the home
cage of a test male. Wild-type males preferred to mount female targets
(Fig. 2a): a higher percentage of Lmx1b1/1 (or ePet1-Cre, Lmx1b1/2)
malesmounted female targets thanmale targets (SupplementaryMovie
2). However, the percentage of Lmx1b2/2 males mounting females was
not significantly different from that mounting males. ePet1-Cre,
Lmx1b1/1 and Lmx1b1/2 males mounted female targets with a shorter
latency, higher frequency and longer duration than male targets
(Fig. 2b, d, e), whereas Lmx1b2/2 males mounted males and females
with similar latencies, frequencies and durations (Supplementary
Movies 2 and 3). Thus, elimination of serotonergic neurons led to a
loss of sexual preference in mounting.
Further analyses were carried out to detect a change in sexual preference
separate from an increase in sexual drive: (1) in the mating
choice assay, all ePet1-Cre, Lmx1b1/1 and Lmx1b1/2 males mounted
females before males, whereas 46.2% of Lmx1b2/2 mounted males first
(Fig. 2c); (2) the mounting frequency ratio of Lmx1b2/2 males in the
mating choice assay (female mounting frequency 2 male mounting
frequency)/(female 1 male mounting) (that is, (R2=/=1R)) was
significantly different from ePet1-Cre, Lmx1b1/1 and Lmx1b1/2 males
(Fig. 2f); and (3) when a test male was presented only with an oestrous
female target, Lmx1b2/2 males were not statistically significant
*These authors contributed equally to this work.
1National Institute of Biological Sciences, Beijing 102206, China. 2Graduate School of the Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing 100730, China. 3Institute of
Neuroscience, Shanghai Institute of Biological Sciences, and Graduate School of the China Academy of Science, China. 4Departments of Anesthesiology, Psychiatry and Developmental Biology, and the Pain
Center, Washington University, School of Medicine, St Louis, Missouri 63110, USA. 5Peking University School of Life Sciences, State Key Laboratory of Membrane Biology, Beijing 100871, China.
0 0 M O N T H 2 0 1 1 | VO L 0 0 0 | N AT U R E | 1
©2011 Macmillan Publishers Limited. All rights reserved
different from wild-type and heterozygous males in male–female
mounting (Supplementary Fig. 1).
We tested male mice for their preference of pheromones present in
the genitals or the bedding. In the genital odour preference assay15, a
slide with one half smeared with female genitals and the other half with
male genitals was presented to a test male. The total time spent sniffing
both halves of the slide was reduced in Lmx1b2/2 males (Supplementary
Fig. 2a). Lmx1b1/1 and Lmx1b1/2 littermates spent significantly
more time sniffing female than male genital odour, whereas Lmx1b2/2
males spent equal time sniffing female and male genital odours
(Fig. 3a). Lmx1b1/1, Lmx1b1/2 and Lmx1b2/2 were similar in the
amount of time spent sniffing male genital odour. Female genital
odour sniffing time was less in Lmx1b2/2 males than in Lmx1b1/1
and Lmx1b1/2 littermates (Fig. 3a). The genital odour preference ratio
(R2=/=1R) of Lmx1b2/2 males was significantly lower than those
of Lmx1b1/1 and Lmx1b1/2 males (Fig. 3b). Compared with
Lmx1b1/1 and Lmx1b1/2 males, a significantly higher percentage
(62.5%) of Lmx1b2/2 males spent more time sniffing male than female
genital odour (Fig. 3c).
In the bedding preference assay16, the total time spent over male and
female bedding was similar among ePet1-Cre, Lmx1b1/1, Lmx1b1/2
and Lmx1b2/2 males (Supplementary Fig. 2b). ePet1-Cre, Lmx1b1/1
and Lmx1b1/2 males spent significantly more time above female than
male bedding whereas Lmx1b2/2 males spent equal time above female
and male beddings (Fig. 3d). Compared with ePet1-Cre, Lmx1b1/1
and Lmx1b1/2 males, Lmx1b2/2 males spent more time above male
bedding and less time above female bedding. The bedding preference
ratio of Lmx1b2/2 males was significantly lower than those of ePet1-
Cre, Lmx1b1/1 and Lmx1b1/2 males (Fig. 3e). The percentage of
males who spent more time above male bedding was significantly
higher in Lmx1b2/2 males (58.8%) than those in ePet1-Cre (0%),
Lmx1b1/1 (6.3%) or Lmx1b1/2 (12.5%) males (Fig. 3f).
Thus, in both the genital odour and bedding assays, Lmx1b2/2
males had lost preference for female pheromones over male pheromones:
in the genital odour preference assay, Lmx1b2/2 males showed
decreased sniffing time for female genital odour; in the bedding preference
assay, Lmx1b2/2 males showed increased time spent over male
bedding and decreased time over female bedding.
Multiple assays involving odour or pheromone sensing were carried
out to test for possible changes in olfaction. In the sesame oil preference
assay17, Lmx1b1/1 and Lmx1b2/2 males were indistinguishable
in spending significantly more time with sesame than air (Supplementary
Fig. 3a). In the fox urine avoidance assay18, Lmx1b1/1 and
Lmx1b2/2 males were also similar (Supplementary Fig. 3b). Thus,
Lmx1b2/2 males were not defective in either innate attractive or avoidance
response.
In the social approach assay19, Lmx1b1/1 and Lmx1b2/2 males
were similar in spending more time close to a strange male than the
empty chamber (Supplementary Fig. 3c).
In the social recognition assay20, Lmx1b1/1 and Lmx1b2/2 males
spent a similar amount of time exploring the first intruder at initial
presentation, displayed social habituation towards the familiar
intruder over the next three presentations and displayed dishabituation
when a new intruder was introduced (Fig. 4a).
An operant conditioning assay was used to test whether Lmx1b2/2
males could distinguish between male and female pheromones21. Two
arms of a T maze were supplied with the odour of either female or male
urine. Electroshock was applied in such a way that the test mice had to
run or stay in the same arm depending on the urine. Over 3 days of
training, Lmx1b1/1 and Lmx1b2/2 males were similar in learning to
avoid punishment (Fig. 4b). Thus, no olfactory defects for general
odours or pheromones were detected in Lmx1b2/2 males.
Results from Lmx1b2/2 mice indicate a role for serotonergic neurons.
To study the role of 5-HT, we used mice unable to synthesize
*
*
f
g
e
90
60
30
90
60
30
90
60
30
90
60
30
90
60
30
90
60
30
90
60
30
90
60
30
90
60
30
90
60
30
90
60
30
90
60
30
40 80 120 40 80 120 0.2 0.4 0.2 0.4
40 80 120 40 80 120 0.2 0.4 0.2 0.4
40 80 120 40 80 120 0.2 0.4 0.2 0.4
Percentage
Lmx1b–/–
Latency (s)
Frequency
Duration (s)
a b c d
0
20
40
60
80
100
ePet1-Cre
Lmx1b+/–
Lmx1b+/+
0
500
1,000
1,500
2,000
0
5
10
15
0
20
40
60
80
Resident
Intruder
0
20
40
60
80
100
0
80
160
240
320
*
*
*
*
Intruder
Time (s)
Lmx1b +/–
Frequency (kHz)
Lmx1b –/–
Frequency (kHz)
Lmx1b +/+
Frequency (kHz)
Lmx1b–/–
ePet1-Cre
Lmx1b+/–
Lmx1b+/+
Lmx1b–/–
ePet1-Cre
Lmx1b+/–
Lmx1b+/+
Lmx1b–/–
ePet1-Cre
Lmx1b+/–
Lmx1b+/+
USV emission number USV emitted (%)
Lmx1b+/+
Lmx1b+/–
Lmx1b–/–
Resident
IntruderePet1-Cre
Lmx1b+/+
Lmx1b+/–
Lmx1b–/–
ePet1-Cre
Lmx1b+/+
Lmx1b+/–
Lmx1b–/–
ePet1-Cre
Lmx1b+/+
Lmx1b+/–
Lmx1b–/–
ePet1-Cre
*** *** *** *** *** ***
*** ***
*** ***
***
***
Figure 1 | Male–male mounting and USV by mice lacking central
serotonergic neurons. a–g, Numbers of mice used and statistical analysis are
all included in Supplementary Data 1. a–d, A test male was presented in its
home cage with an adult wild-type male and its behaviour was recorded for
30 min (all data shown as mean6 s.e.m.). Compared with Lmx1b1/1,
Lmx1b1/2 or ePet1-Cre, Lmx1b2/2 males mounted males at a higher
percentage (a), lower latency (b), higher frequency (c) and for a longer duration
(d). e, Typical USV patterns emitted by males when presented with female or
male intruders. The two left panels show USVs in 2 min, whereas the two right
panels show parts of USV graphs at higher magnifications. f, Female intruders
elicited USV from almost all ePet1-Cre, Lmx1b2/2, Lmx1b1/1, or Lmx1b1/2
males . Male intruders elicited USVs more from Lmx1b2/2 males than from
ePet1-Cre, Lmx1b1/1 or Lmx1b1/2 males. g, The number of USVs emitted by
Lmx1b2/2 males towards males is higher than those by ePet1-Cre, Lmx1b1/1
or Lmx1b1/2 males, whereas ePet1-Cre, Lmx1b1/1, Lmx1b1/2 and Lmx1b2/2
males were similar in USVs towards females. *P,0.05, **P,0.01,
***P,0.001.
RESEARCH LETTER
2 | N AT U R E | VO L 0 0 0 | 0 0 MO N T H 2 0 1 1
©2011 Macmillan Publishers Limited. All rights reserved
5-HT in the brain. 5-HT is synthesized in two steps: tryptophan is
converted by a Tph into 5-HTP, which is converted into 5-HT by
5-hydroxytryptophan decarboxylase and aromatic L-amino-acid
decarboxylase.
There are two Tph enzymes: Tph2 is required centrally and Tph1
peripherally. We have generated Tph22/2 mice (J.-Y.K. et al., manuscript
in preparation), which were viable22–24. High-performance liquid
chromatography (HPLC) analysis showed that the 5-HT level was
significantly reduced in the brains of Tph22/2 males (Supplementary
Fig. 4a). Male–male mounting (Supplementary Movie 4) was
significantly higher in Tph22/2 males than either Tph21/1 or heterozygous
Tph21/2 males: the percentage was significantly higher, duration
longer, latency shorter and frequency higher (Supplementary Fig.
4b, c and Fig. 5a, b). In the bedding preference assay, both Tph21/1
and Tph21/2 males preferred female over male bedding, whereas
Tph22/2 males showed no preference (Fig. 5c). In the genital odour
preference assay, both Tph21/1 and Tph21/2 males preferred female
over male genital odour, but Tph22/2 males showed no preference
(Fig. 5d).
When presented with an oestrous female target, male–female
mounting was not significantly changed in Tph22/2 males (Supplementary
Fig. 5). In mating choice, Tph22/2 males had lost preference
for females over males in percentage, latency, frequency and
duration (Supplementary Fig. 6a, b, d, e). No control males mounted
target males before females, whereas more than 40% of Tph22/2 males
mountedmales first (Supplementary Fig. 6c). The mounting frequency
ratio of Tph22/2 males was significantly different from those of
Tph21/1 and Tph21/2 males (Supplementary Fig. 6f).
Lmx1b2/2 and Tph22/2 mice lack 5-HT from embryogenesis. To
study the role of 5-HT in adulthood, we took two complementary
approaches: first, we depleted 5-HT from adult mice pharmacologically
with pCPA25; then we attempted to rescue the phenotype of adult
Tph22/2 mutants.
Adult C57BL/6J males were injected with either pCPA or saline for
three consecutive days. 5-HT level was significantly reduced by pCPA
d
Mount male first (%)
*
*
e
Frequency
** *
*
**
c
Duration (s)
** *
*
*
Choice (%)
Latency (s)
* **
*
*
a b
* *
*
*
Frequency ratio
**
f
0
20
40
60
80
100
200
400
600
800
1,000
0
10
20
30
40
50
0
5
10
15
0
20
40
60
80
0.0
0.2
0.4
0.6
0.8
1.0
Lmx1b+/+
ePet1-Cre
Lmx1b+/–
Lmx1b–/–
*
*
*
* *
**
*
**
*
**
**
Lmx1b+/+
ePet1-Cre
Lmx1b+/–
Lmx1b–/–
Lmx1b+/+
ePet1-Cre
Lmx1b+/–
Lmx1b–/–
Lmx1b+/+
ePet1-Cre
Lmx1b+/–
Lmx1b–/–
Lmx1b+/+
ePet1-Cre
Lmx1b+/–
Lmx1b–/–
Lmx1b+/+
ePet1-Cre
Lmx1b+/–
Lmx1b–/–
0
Figure 2 | Lack of sexual preference by mice without central serotonergic
neurons. a–f, Each test male was presented with a male and an oestrous female,
and its mating choice was analysed for 15 min. a, More ePet1-Cre, Lmx1b1/1
and Lmx1b1/2 males mounted female than male targets. A similar percentage
of Lmx1b2/2 males mounted females and males. b, ePet1-Cre, Lmx1b1/1 and
Lmx1b1/2 males mounted female targets faster than male targets. Mounting
latencies of Lmx1b2/2 males for females and males were similar. c, More than
40% of Lmx1b2/2 males but none of the ePet1-Cre, Lmx1b1/1 or Lmx1b1/2
males chose a male as their first mounting target. d, ePet1-Cre males mounted
females significantly more often than males, as did Lmx1b1/1 and Lmx1b1/2
males. Lmx1b2/2 males mounted females as often as males (P.0.05, t-test).
e, ePet1-Cre males spent more time mounting females than males, as did
Lmx1b1/1 and Lmx1b1/2 males. Lmx1b2/2 males did not show differences in
mounting males or females. f, The mounting frequency ratio of Lmx1b2/2 was
different from that of ePet1-Cre, Lmx1b1/1 and Lmx1b1/2. *P,0.05,
**P,0.01, ***P,0.001.
Sniffing time of or
**
**
Sniffing time (s)
Time on or bedding
*** **
Time on bedding (s)
Lmx1+/+
Lmx1+/–
Lmx1–/–
a b c
d e f
Genital odour sniffing ratio
Lmx1+/+
Lmx1+/–
Lmx1–/–
Sniffing index
Percentage preferring
genital odour
Lmx1+/+
Lmx1+/–
Lmx1–/–
***
*
Male preferring (%)
Percentage preferring
bedding
Lmx1+/+
Bedding time ratio
Lmx1+/+
Lmx1+/–
Lmx1–/–
Bedding time index
*** **
–0.4
–0.2
0.0
0.2
0.4
0.6
0
5
10
15
20
25
0
20
40
60
80
** ***
*
*
*
**
genital odour
0
50
100
150
200
ePet1-Cre
–0.4
–0.2
0.0
0.2
0.4
ePet1-Cre
0
20
40
60
80
Lmx1+/+
Lmx1+/–
Lmx1–/–
ePet1-Cre
** ***
***
**
** *
*
**
Lmx1+/–
Lmx1–/–
Male preferring (%)
Figure 3 | Loss of sexual preference for genital odour and bedding by males
without central serotonergic neurons. a, Lmx1b1/1 males spent more time
sniffing female than male genital odour, as did Lmx1b1/2 males. Lmx1b2/2
males spent a similar amount of time on female and male genital odour. Three
groups were not significantly different in male genital odour sniffing time but
Lmx1b2/2 males spent less time sniffing female genital odour than the other
two groups. b, Sniffing ratio ofLmx1b2/2 males was significantly different from
Lmx1b1/1 and Lmx1b2/2 males (P,0.05 for Lmx1b1/1 versus Lmx1b2/2,
P,0.05 for Lmx1b1/2 versus Lmx1b2/2, P.0.05 for Lmx1b1/1 versus
Lmx1b1/2; one-wayANOVA). c, Compared with Lmx1b1/1 and Lmx1b1/2, a
higher percentage of Lmx1b2/2 males spent more time sniffing male than
female genital odour. d, ePet1-Cre males spent more time above female bedding
than male bedding, as did Lmx1b1/1 and Lmx1b1/2 males. Lmx1b2/2 males
spent a similar amount of time above female and male bedding. Compared with
ePet1-Cre, Lmx1b1/2 and Lmx1b1/1, Lmx1b2/2 males spent less time above
female bedding but more time above male bedding. e, The bedding time ratio of
Lmx1b2/2 was different from ePet1-Cre and Lmx1b1/1. f, Compared with
ePet1-Cre, Lmx1b1/1 and Lmx1b1/2, a significantly higher percentage of
Lmx1b2/2 males spent more time above male bedding. *P,0.05, **P,0.01,
***P,0.001.
Social memory
1 2 3 4 5
0
20
40
60
Lmx1b+/+
Lmx1b–/–
Adaptive operational
learning with pheromone
1 2 3 4 5 6 7
0
20
40
60
80
100
Lmx1b+/+
Lmx1b–/–
Approaching (%)
Correct response (%)
Trial Trial
a b
Figure 4 | Odour discrimination. a, Both Lmx1b1/1 and Lmx1b2/2 males
showed habituation and dishabituation in sniffing time. No statistical
difference was found between Lmx1b1/1 and Lmx1b2/2 males at any point.
b, After seven training sessions with male and female urine, no significant
difference was detected between Lmx1b1/1 and Lmx1b2/2 males at any point.
LETTER RESEARCH
0 0 M O N T H 2 0 1 1 | VO L 0 0 0 | N AT U R E | 3
©2011 Macmillan Publishers Limited. All rights reserved
(Supplementary Fig. 7). pCPA-treated males showed shorter latency,
higher frequency and longer duration than control males in mounting
target males (Supplementary Fig. 8a–d), and lost bedding preference
(Supplementary Fig. 8e, f).
To test whether 5-HTP injection into adult mice could rescue the
Tph22/2 phenotype, we examined first whether 5-HTP could rescue
5-HT synthesis in Tph22/2 males and found that 5-HT levels were
restored 35 min after intraperitoneal injection of 5-HTP but not saline
(Fig. 6a and Supplementary 9a, b).
5-HTP significantly reduced male–male mounting of Tph22/2
males: the percentage was decreased, latency increased, frequency
decreased and duration shortened; all returning to wild-type levels
(Fig. 6b, c and Supplementary Fig. 9c, d). 5-HTP rescued the loss of
sexual preference in mounting latency, frequency and duration in the
mating choice assay (Supplementary Fig. 10a–c) and the bedding preference
of Tph22/2 males (Fig. 6d and Supplementary Fig. 9e).
When a test male was presented with a target female, Tph22/2 males
were similar to wild-type and heterozygous males in mounting percentage,
latency, frequency and duration (Supplementary Figs 5, 11).
5-HTP injection into Tph22/2 males did not affect male–female
mounting (Supplementary Fig. 11), although 5-HTP injection into
wild-type males reduced male–female mounting. Because 5-HTP
injection in wild-type males increased the level of 5-HT beyond the
wild-type level (Supplementary Fig. 9a, b), it indicated a dosagesensitive
effect of 5-HT: 5-HT at concentrations above the wild-type
level inhibited male–female mounting, but 5-HT concentrations
between the wild-type and Tph22/2 levels did not affect male–female
mounting.
We conclude that central serotonergic signalling is crucial for male
sexual preference in mice. This is the first time, to our knowledge, that
a neurotransmitter in the brain has been demonstrated to be important
in mammalian sexual preference. Previous studies in mammals have
implicated 5-HT and dopamine in male sexual behaviours, but neither
has been demonstrated to have any role in sexual preference: dopamine
is thought to facilitate male sexual behaviours whereas 5-HT is
thought to inhibit sexual behaviours7–11,26. Our studies have established
a role for 5-HT in male sexual preference. Multiple results showed a
loss in sexual preference beyond or separate from hypersexuality: (1)
the ratio of male–male and male–female interactions was repeatedly
measured to analyse sexual preference (Figs 2f, 3b, e, 5c, d, 6d and
Supplementary Figs 6f, 8f, 9e, 10d); (2) Lmx1b2/2 males showed
increased USVs towards males but not towards females (Fig. 1g); (3)
in mating choice, the latency, frequency and duration of Lmx1b2/2
males to mount males, but not to mount females, was changed (Fig. 2a,
b, d, e); (4) in bedding preference, Lmx1b2/2 (Fig. 3d) and Tph22/2
males (Figs 5c, 6d) showed an increase in time spent overmale bedding
but a decrease in time over female bedding; (5) wild-type males always
mounted females before males but a significant fraction of Lmx1b2/2
or Tph22/2 males mounted males first (Fig. 2c and Supplementary Fig.
6c); (6) in the genital odour preference assay, both Lmx1b2/2 (Fig. 3a)
and Tph22/2 (Supplementary Fig. 5d) males showed a decrease in time
on female genital odour, which could not be explained by hypersexuality;
and (7) when presented with an oestrous target female, neither
Lmx1b2/2 males (Supplementary Fig. 1) nor Tph22/2 males (Supplementary
Fig. 5) were different from wild-type males.
Increased sexual drive was observed in males lacking 5-HT when
they were tested in the presence of live target males and females
(Supplementary Fig. 6). This has been noted before in mice defective
for Trpc2 and vomeronasal organ olfaction5,6. Trpc22/2 males have
been previously reported to have lost male–female preference in mating
choice5,6. Trpc22/2 males showed increased mounting of both
males and females (figure 2c in ref. 6). The conclusion of a loss in
sexual preference in Trpc22/2 males was inferred from a relative
change: Trpc22/2 males showed a 2-fold preference for females over
males whereas the wild-type showed a 10-fold preference. The phenotypes
reported here for Lmx1b2/2, Tph22/2 males and pCPA-treated
males were stronger than for Trpc22/2 males in mating choice: these
males did not show significant preference for females (Fig. 2 and
Supplementary Fig. 6).
At present, it is not known whether 5-HT regulates the vomeronasal
organ pathway in pheromone sensing or acts further downstream in
behavioural decisions. Differences have been noted between Trpc2 and
Lmx1b in the brain: aggression was largely lost in Trpc22/2, but not
Lmx1b2/2, mice (data not shown). It is more likely that 5-HTregulates
central decision-making than influencing peripheral olfaction.
However, we cannot completely rule out the possibility that 5-HT
regulates a specific innate olfactory pathway processing sexual
information27. In mice, it will be interesting to identify specific subsets
of serotonergic neurons and serotonergic receptors involved in sexual
preference.
An unavoidable question raised by our findings is whether 5-HT has
a role in sexual preference in other animals. In a positron emission
tomography study of humans, the response of heterosexual men to the
selective serotonin reuptake inhibitor (SSRI) fluoxetine was found to
be different from that of homosexual men28. SSRIs inhibited compulsive
sexual behaviours in homosexual and bisexual men29. However, so
far, none of these studies has investigated whether 5-HT has a role in
Mounting latency
Time (s)
Time (s)
Number
Time (s)
Tph2+/+
Tph2+/–
Tph2–/–
a Mounting frequency
0
50
100
150
200
b
**
c
Tph2+/+
Tph2+/–
Tph2–/–
0
500
1,000
1,500
2,000
*
*
0
10
20
30
40
*
*
0
5
10
15
20
d
*** **
*
Bedding preference Genital odour preference
Tph2+/+
Tph2+/–
Tph2–/–
**
Tph2+/+
Tph2+/–
Tph2–/–
Figure 5 | Brain chemistry and behaviours of Tph2 knockout males.
a, b, Compared with Tph21/1 and Tph21/2, Tph22/2 males showed a shorter
latency (a) and higher frequency in mounting males (b). c, Both Tph21/1 and
Tph21/2 males significantly preferred female over male bedding, whereas
Tph22/2 males did not show a preference between male and female bedding.
d, Both Tph21/1 and Tph21/2 males significantly preferred female over male
genital odour, whereas Tph22/2 males did not show a preference between male
and female genital odour. *P,0.05, **P,0.01, ***P,0.001.
b c
Response (nA)
350
0
350
0
Retention time (min)
Raphe
Brain
5-HIAA
5-HT
HVA
5-HIAA
5-HT
HVA Tph2 5-HTP
a
–– +– + +
+ –
Tph2 5-HTP
–– +– + +
+ –
Mounting latency Mounting frequency d Bedding preference
+
–
+
+
–
–
–
+
Tph2
5-HTP
** **
0
50
100
150
200
250
+
–
+
–
–
–
–
–
+
+
+
+
–
+
–
+
Bedding
Tph2
5-HTP
*** *** ***
0
500
1,000
1,500
2,000
Time (s)
Time (s)
Number
*** ***
0
20
40
60
*** ***
***
*
**
*
+
–
+
+
–
–
–
+
Tph2
5-HTP
10 12 14 16 18 20
10 12 14 16 18 20
Figure 6 | 5-HTP rescue of chemical and behavioural deficits in Tph2
knockout mice. a, Levels of 5-HT and 5-hydroxyindoleacetic acid (5-HIAA)
were analysed in Tph21/1 and Tph22/2 males 35 min after injection of either
5-HTP (40 mgkg21 body weight) or control saline. b, c, Male–male mounting
in Tph22/2 mice was significantly rescued by 5-HTP: the latency was
lengthened and frequency reduced. d, Bedding preference was monitored
between 35 and 40 min after injection. 5-HTP could significantly restore the
preference of female over male bedding by Tph22/2 males.
RESEARCH LETTER
4 | N AT U R E | VO L 0 0 0 | 0 0 M O N T H 2 0 1 1
©2011 Macmillan Publishers Limited. All rights reserved
sexual preference. Attempts have been made to map genetic loci affecting
human sexuality30, although specific genes have not been identified.
Our discovery of a role for serotonergic signalling in mouse
sexual preference should stimulate further studies into the role of
5-HTin sexual interactions in particular and roles of neurotransmitters
in mammalian social relationships in general.
METHODS SUMMARY
We used conditional knockout mice for Lmx1b and knockout mice for Tph2.
Levels of 5-HT in these mice and their heterozygous and wild-type littermates
were measured by HPLC. Most of the behavioural assays were similar to established
methods.
Full Methods and any associated references are available in the online version of
the paper at www.nature.com/nature.
Received 12 August 2010; accepted 14 January 2011.
Published online 23 March 2011.
1. Trivers, R. L. Parent–offspring conflict. Am. Zool. 14, 249–264 (1974).
2. Sommer, V. & Vasey, P. L. Homosexual Behaviour in Animals: An Evolutionary
Perspective (Cambridge Univ. Press, 2006).
3. Price, E. O. & Wallach, S. J. Development of sexual and aggressive behaviors in
Hereford bulls. J. Anim. Sci. 69, 1019–1027 (1991).
4. Erwin, J.&Maple, T.Ambisexual behavior with male–male anal penetrationin male
rhesus monkeys. Arch. Sex. Behav. 5, 9–14 (1976).
5. Stowers, L., Holy, T. E., Meister, M., Dulac, C. & Koentges, G. Loss of sex
discriminationandmale–male aggressioninmice deficient forTRP2. Science295,
1493–1500 (2002).
6. Leypold, B. G. et al. Altered sexual and social behaviors in trp2 mutant mice. Proc.
Natl Acad. Sci. USA 99, 6376–6381 (2002).
7. Hull, E. M., Muschamp, J. W. & Sato, S. Dopamine and serotonin: influences on
male sexual behavior. Physiol. Behav. 83, 291–307 (2004).
8. Hull, E. M. & Dominguez, J. M. Sexual behavior in male rodents. Horm. Behav. 52,
45–55 (2007).
9. Ferguson, J. et al. ‘‘Hypersexuality’’ and behavioral changes in cats caused by
administration of p-chlorophenylalanine. Science 168, 499–501 (1970).
10. Malmna¨s, C. & Meyerson, B. p-Chlorophenylalanine and copulatory behaviour in
the male rat. Nature 232, 398–400 (1971).
11. Salis, P. & Dewsbury, D. p-Chlorophenylalanine facilitates copulatory behaviour in
male rats. Nature 232, 400–401 (1971).
12. Dailly, E., Chenu, F., Petit-Demouliere, B. & Bourin, M. Specificity and efficacy of
noradrenaline, serotonin depletion in discrete brain areas of Swiss mice by
neurotoxins. J. Neurosci. Methods 150, 111–115 (2006).
13. Zhao, Z.-Q. et al. Lmx1b is required for maintenance of central serotonergic
neurons and mice lacking central serotonergic system exhibit normal locomotor
activity. J. Neurosci. 26, 12781–12788 (2006).
14. Guo, Z. & Holy, T. E. Sex selectivity of mouse ultrasonic songs. Chem. Senses 32,
463–473 (2007).
15. Ferkin, M. H. & Li, H. Z. A battery of olfactory-based screens for phenotyping the
social and sexual behaviors of mice. Physiol. Behav. 85, 489–499 (2005).
16. Moncho-Bogani, J., Lanuza, E., Herndez, A., Novejarque, A. & Martez-Garc, F.
Attractive properties of sexual pheromones in mice: innate or learned? Physiol.
Behav. 77, 167–176 (2002).
17. Burwash, M. D., Tobin, M. E.,Woolhouse, A. D.&Sullivan, T. P.Laboratory evaluation
of predator odors for eliciting an avoidance response in roof rats (Rattus rattus).
J. Chem. Ecol. 24, 49–66 (1998).
18. Blanchard, D. et al.Failure toproduceconditioningwithlow-dose trimethylthiazoline
or cat feces as unconditioned stimuli. Behav. Neurosci. 117, 360–368 (2003).
19. Nadler, J. J. et al. Automated apparatus for quantitation of social approach
behaviors in mice. Genes Brain Behav. 3, 303–314 (2004).
20. Ferguson, J. N. et al. Social amnesia in mice lacking the oxytocin gene. Nature
Genet. 25, 284–288 (2000).
21. Yan, Z. et al. Precise circuitry links bilaterally symmetric olfactorymaps. Neuron 58,
613–624 (2008).
22. Gutknecht, L. et al. Deficiency of brain 5-HT synthesis but serotonergic neuron
formation in Tph2 knockout mice. J. Neural Transm. 115, 1127–1132 (2008).
23. Savelieva, K. V. et al. Genetic disruption of both tryptophan hydroxylase genes
dramatically reduces serotonin and affects behavior in models sensitive to
antidepressants. PLoS ONE 3, e3301 (2008).
24. Alenina, N. et al. Growth retardation and altered autonomic control in mice lacking
brain serotonin. Proc. Natl Acad. Sci. USA 106, 10332–10337 (2009).
25. Koe, B. K. & Weissman, A. p-Chlorophenylalanine: a specific depletor of brain
serotonin. J. Pharmacol. Exp. Ther. 154, 499–516 (1966).
26. Gawienowski, A. M. & Hodgen, G. D. Homosexual activity in male rats after
p-chlorophenylalanine: effects of hypophysectomy and testosterone. Physiol.
Behav. 7, 551–555 (1971).
27. Kobayakawa, K. et al. Innate versus learned odour processing in the mouse
olfactory bulb. Nature 450, 503–508 (2007).
28. Kinnunen, L., Moltz, H., Metz, J. & Cooper, M. Differential brain activation in
exclusively homosexual and heterosexual men produced by the selective
serotonin reuptake inhibitor, fluoxetine. Brain Res. 1024, 251–254 (2004).
29. Wainberg, M. et al. A double-blind study of citalopram versus placebo in the
treatment of compulsive sexual behaviors in gay and bisexual men. J. Clin.
Psychiatry 67, 1968–1973 (2006).
30. Mustanski, B. S. et al. A genomewide scan of male sexual orientation. Hum. Genet.
116, 272–278 (2005).
Supplementary Information is linked to the online version of the paper at
www.nature.com/nature.
Acknowledgements We are grateful to E. S. Deneris for ePet1-Cre mice; to R. Johnson
for Lmx1bfl mice; to M. Luo for discussions; to Z. Yan and Y. Lu for the operant
conditioning apparatus; to X.Wang and Y. Wan for help with HPLC; to J. Lang and J. Yin
formouse breedingand genotyping; to P. Ding, P.Wang, H.Lu and X.Wangfor technical
assistance; to L.Zhao, Z. Qiuand H. Jingfor animal caring; and to the Ministry of Science
and Technology (973 program 2010CB833901) and Beijing Municipal Commission
on Science and Technology for grant support (to Y.R.), and the NIHfor grant support (to
Z.-F.C.).
Author Contributions Y.R. conceived the project, Y.R., Y.L. and Y.J. designed the
experiments, Y.L., Y.J. and Y.S. performed the experiments, J.-Y.K. and Z.-F.C.
contributed the Tph2 knockout mutants, Y.R., Y.L. and Y.J. wrote the paper.
Author Information Reprints and permissions information is available at
www.nature.com/reprints. The authors declare no competing financial interests.
Readers are welcome to comment on the online version of this article at
www.nature.com/nature. Correspondence and requests for materials should be
addressed to Y.R. ([email protected]).
LETTER RESEARCH
0 0 M O N T H 2 0 1 1 | VO L 0 0 0 | N AT U R E | 5
©2011 Macmillan Publishers Limited. All rights reserved
METHODS
Mouse stocks. ePet1-Cre mice were a gift from E. S. Deneris and the floxed Lmx1b
mice were a gift fromR. Johnson. Tph2 knockout mice were generated by deleting
exon 5, which encodes the tryptophan hydroxylase domain (for details see J.-Y.K.
et al., manuscript submitted). Mice were weaned at the age of 21 days. Mice were
maintained on a 12 h light, 12 h dark schedule and housed initially in groups of five
up to the tenth week and then singly housed until the end of experiments. Food and
water were provided ad libitum. Room temperature was 2361 uC. Humidity was
40–60%. All test mice were 12–16 weeks old. The target mice were 11–13 weeks old.
Mouse genotyping. Genomic DNA was extracted from mouse tail tissues at the
day of weaning. Mutant mice were generated by crossing ePet1-Cre mice with
floxed Lmx1b mice and following intercross within the F1 generation mice.
Littermates used in the tests were of the same sex and similar body weight as
the knockout mice. The primers were: AGGCTCCATCCATTCTTCTC (floxed
Lmx1b1); CCACAATAAGCAAGAGGCAC (floxed Lmx1b2); ATTTGCCTGCA
TTACCGGTCG (Cre1); CAGCATTGCTGTCACTTGGTC (Cre2).
Immunocytochemical analysis with anti-5-HT antibodies confirmed that
5-HT-positive neurons were absent in Lmxb1 knockout mice (data not shown).
The Tph2 line was maintained by crossing heterozygotes. Littermates included
wild-type, heterozygotes and homozygous knockout mice. The primers for genotyping
were: GGGCATCTCAGGACGTAGTAG; GGGCCTGCCGATAGTAA
CAC; GCAGCCAGTAGACGTCTCTTAC.
Measurement of 5-HT. The levels of 5-HT and its metabolites were separated by
HPLCand measured by an electrochemical detector in samples fromadultmale mice.
In 5-HTP rescue experiments, mice were injected with 40mg kg21 5-HTP or saline
(both at the volume of 5ml kg21). They were euthanized 35min later. The brain was
dissected and the raphe region was isolated on ice. Samples were weighed before
ultrasonication. Monoamines were extracted by perchloric acid. The sample was
filtrated by 0.22 mmfilter before being injected into RP-HPLC (ESA).Noradrenaline,
3,4-dihydroxyphenylacetic acid (DOPAC), dopamine, HIAA, homovanillic acid
(HVA) and 5-HT were measured by an electrochemical detector. Their concentrations
were calculated by CoulArray software (ESA) based on standard samples.
Values of amine per wet tissue weight are shown in the final figures.
Order of behavioural assays. Male mutant mice and their littermates at 12–13
weeks of age and of similar body weight were sexually naive and group-housed
with same-sex mice before 10 weeks of age. After 2 weeks of single housing, mice
were tested in the following order: bedding preference, male–male resident–
intruder assay, mating choice assay, sexual behaviours with an oestrous female,
bedding preference again (no difference was observed with results from the first
bedding preference). Mice were given one week of rest between each test. For
Lmx1b mice, the same group of mice were used in male–male mounting, mating
choice and male–female mounting. For Tph2 mice, a different group were used for
male–female mounting. Sexually experienced mice were used for USV, social
approach, habituation and olfactory learning assays. Sexually naive mice were
used for urine preference and olfactory tests.
Resident–intruder tests. All test mice were sexually naive. The bedding of the test
mice had not been changed for at least 4 days. Intruder mice were 11–13 weeks old,
sexually naive and group-housed C57Bl/6J males. All activities within a test were
recorded by an infrared camera (Sony Video Recorder, DCR-HC26C). Mounting
latency, mounting frequency and total duration of mounting within 30min were
measured.
Mating choice assay. Beddings of test mice had not been changed for at least four
days.Agroup-housed sexually naive 11–13 week-old C57Bl/6J male and a sexually
naive oestrous 10-week-old female C57Bl/6J female were introduced into the cage
of each test male. Each assay lasted 15 min after the target mice were introduced.
All activities were recorded by an infrared camera. The latency, frequency and
duration of mounting of male or female targets were analysed.
Sexual behaviours with females. An oestrous female was presented to a test male
and video was recorded for 30 min using an infrared camera. The latency, frequency
and duration of male mounting of the female were analysed.
USVs. Tests were carried out with singly housed adult males during the dark phase
in the home cage. UltraSoundGate 116-200 system (Avisoft) was used to record
the ultrasound. We recorded the background sound for 1 min before a stimulus
mouse of 10–13 weeks old was introduced. The recording lasted for 2 min.
Recorded data was analysed with SASLab (Avisoft)5. Sounds over the frequency
range of 30–110kHz were analysed. Profiles of background noise created by
mouse movement were very different from USVs. To confirm that the resident
mouse was the source of USVs, we recorded from assays in which either the
resident or the intruder mouse was devocalized. We were able to record robust
USVs (presented in our figures) only when the intruder mouse was devocalized
and not when the resident mouse was devocalized.
Genital odour preference assay. This assay was modified from a previously
described procedure15. The anogenital area scent from a male was rubbed on
the left or right side of a clean glass microscope slide while the anogenital area
scent froma female was rubbed on the other side of the slide. Five seconds later, the
slide was hung in the middle of the cage by a clamp. The slides were,5 cmover the
bedding. Activities of the test mice were recorded for 3 min by an infrared camera
and the sniff time on the scent portion on either side was analysed as was the
amount of time a test male licked the slide or its nose touched the slide.
Bedding preference assay. Bedding from group-housed adult C57BJ/6J males or
females was not changed for 4 days. Ten grams of male or female bedding were put
in one side on the bottom of a cage in an area of 11.5317cm2. Male and female
beddings were prevented from mixing by a plastic bar of 6 cm. The size of cage was
29317315 cm (length3width3height)16. A grid of plastic bars separated the
test mice from the bedding on the bottom of the cage. The bars were 5mm wide
with 5mm intervals. The test mouse was put into the cage to be familiarized with
the cage without bedding for 5 min before the mice were taken out and the bedding
and a clean grid was put into the cage. After each assay, the cage was washed with
water and then alcohol to remove odour.
Olfactory learning assay.We employed a T maze in which electric shock could be
applied to either side of the horizontal chamber as described previously21. Briefly,
there was a door at the intersection of the horizontal and vertical chambers. The
horizontal chamber of 838360cm3 was divided into three parts: a left arm of
838323cm, a right arm of 838323cm and a middle zone of 838314cm.
Each test mouse was introduced into the vertical chamber of the T maze. After it
entered the horizontal chamber, the door between the vertical and horizontal
chambers was closed and the mouse was allowed to walk within the horizontal
chamber. The mouse was not allowed to stay in the middle zone for longer than 8 s,
otherwise it would be punished with electroshock. The position of the test mouse
was monitored by a video recorder. Urine samples were collected from more than
20C57BL/6Jmales or females and stored at220 uC.A1.5ml urine sample was used
for each test. The odour ofmale or female urinewas puffed into the left or right arm
of the horizontal chamber and expirated from the middle zone. Odour was presented
for 50 s.We trained the testmale mouse with electroshock to stay in the arm
with female odour and to avoid the armwith male odour. Themouse had tomake a
decision to stay in or leave the arm when an odour was presented. Each training
session of 18 trials lasted for 30min. Everymousewas given 6 training sessions over
3 days before the final test. There were 10 trials in the final test. The percentages of
correct choices in every training session and the final test were analysed.
Innate behavioural responses to odours. The set-up is the same as that for the
olfactory learning assay, except that no electroshock was applied. Sexually naive
males (mutants or littermates) of 10–16 weeks old were tested for their choices of
fox urine versus air, or sesame oil versus air. Fox urine was used to test the innate
avoidance of a predator’s odour. Fox urine was diluted at two concentrations (603
and 203). The main air flow velocity was 250 l h21. The air flow through fox urine
was 70 ml min21 or 210 ml min21, respectively. The time that mice spent in the
empty arm or the fox urine arm was recorded by Matlab software. Sesame oil
diluted 833was used to test innate attraction to food. Time spent in the air arm or
the sesame oil arm was recorded by Matlab software.
Social approach. The social approach experiment was tested in a modified
T-shaped box. There was a small cage separated by wire at each end of the arms
in the horizontal chamber. A test mouse was allowed to habituate for five minutes
before an unfamiliar target male was randomly placed in one of the small cages.
The target mouse could be seen, smelled and heard, but could not be touched. The
test mouse was allowed to move in the box for 5 min. Its location was video
recorded and analysed by a computer.
Social memory. Singly housed adult males were tested in the dark phase and in the
room where they were reared. Ovariectomized C57Bl/6J females were used as
stimulus mice20. They were ovariectomized at 6 weeks old and used 2 weeks later.
Astimulus mouse was introduced into the cage housing a test mouse for 1 min and
then was removed. After an interval of 10 min, the same stimulus female was
introduced again for 1 min. The stimulus mouse was presented four times. On
the fifth time, a new stimulus mouse was introduced for 1 min. The behaviour of
test mice was videotaped and time spent on body sniffing was analysed.
5-HT depletion by pCPA treatment. Male C57Bl/6J mice of 11–13 weeks of age
were used. They were injected with either 500mgkg21 of pCPA (Sigma, C6506) or
saline control for 3 consecutive days after 4 days of being singly housed. Animals
were tested with adult C57 female mice. Mice that did not show mounting behaviour
in 15 min were discarded. Mice that qualified were then singly housed for 1
week before social behaviour testing and their bedding was not changed. Animals
were randomly divided into pCPA or saline treatment groups. pCPA was suspended
in 1% Tween saline at a concentration of 50mgml21. The pCPA group
were injected intraperitonially with pCPA (10 ml kg21) at 72, 48 and 24 h before
testing. The control group received 1% Tween saline. Resident–intruder and mating
choice assays were carried out. Behavioural tests were performed in the dark.
RESEARCH LETTER
©2011 Macmillan Publishers Limited. All rights reserved |